View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15805_low_14 (Length: 296)
Name: NF15805_low_14
Description: NF15805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15805_low_14 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 296
Target Start/End: Complemental strand, 33949311 - 33949016
Alignment:
| Q |
1 |
ataaatcaaagacgttgtctgaattaatatccccatagatgccacagtggcagtggggtccgcaagaaatccacacaaaactatcacaatctcataccac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33949311 |
ataaatcaaagacgttgtctgaattaatatccccatagatgccacagtggcagtggggtccacaagaaatccacacaaaactatcacaatctcataccac |
33949212 |
T |
|
| Q |
101 |
caccactctaaacaaaccgaaacacaactcggcgcagctagcttaatcaacgacccccacccnnnnnnncactcccggctcggagcattccatgtggcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33949211 |
caccactctaaacaaaccgaaacacaactcggcgcagctagcttaatcaacgacccccacccaaaaaaacactcccggctcggagcattccatgtggcaa |
33949112 |
T |
|
| Q |
201 |
tgtggaccccacttatccaaacataaaccgccgatacaaccaaaactcaaaaattggaggcagcagaagcaatggcaataccagaaataccctttt |
296 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33949111 |
tgtggaccccacttatccaaacataaaccaccaatacaaccaaaactgaaaaattggaggcagtagaagcaatggcaataccagaaataccctttt |
33949016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 70 - 126
Target Start/End: Complemental strand, 51875032 - 51874976
Alignment:
| Q |
70 |
tccacacaaaactatcacaatctcataccaccaccactctaaacaaaccgaaacaca |
126 |
Q |
| |
|
||||||||||| ||||| | |||||||||||||| ||||||||||| |||||||| |
|
|
| T |
51875032 |
tccacacaaaattatcatgagttcataccaccaccattctaaacaaacagaaacaca |
51874976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University