View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15805_low_16 (Length: 273)
Name: NF15805_low_16
Description: NF15805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15805_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 44393812 - 44393550
Alignment:
| Q |
1 |
ctttcacactccaccacaattcttgttgatggatcttcagagtggaagaaccccactgtttccattggtgattccatcagtaagtattatcaccataaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44393812 |
ctttcacactccaccacaattcttgttgatggatcttcagagtggaagaaccctactgtttccattggtgattccatcagtaagtattatcaccataaaa |
44393713 |
T |
|
| Q |
101 |
caattgcagctagctaacattactctgtttcttctctgttttcactctgtttttctctgtttcagctttcaagcacaagcaaaactacaacctctacatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44393712 |
caattgcagctagctaacattactctgtttcttctctgttttcactctgtttttctctgtttcagctttcaagcacaagcaaaactacaacctctacatt |
44393613 |
T |
|
| Q |
201 |
ttcaagaaccagaaagccttcaatctctgcaatttcactcaagccaatcttctctctgctcct |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
44393612 |
ttcaagaaccagaaagccttcaatctctgcaatttcactcaagccaatcttctcactgatcct |
44393550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University