View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15806_low_4 (Length: 349)
Name: NF15806_low_4
Description: NF15806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15806_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 279
Target Start/End: Complemental strand, 43960481 - 43960216
Alignment:
| Q |
16 |
aatatgccaacgggatacgtaaggaatttgtttggtatgggaagtgtttttattcatagtctctcaacgtcacaaggcaaaatcactgtcactataataa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43960481 |
aatatgccaacgggatacgtaaggaatttgtttggtatgggaagtgttcttattcatagtctctcaacgtcacaaggcaaaatcactgtcactataataa |
43960382 |
T |
 |
| Q |
116 |
tgataaaataggagcgatcaatttatttacttgataaattactctcatcttcggtcaaaagaagaa-aaaacatttactctcacctcttaagatgccaat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
43960381 |
tgataaaataggagcgatcaatttatttacttgataaattactctcatcttcggtcaaaagaagaaaaaaaaacttactctcacctcttaagatgccaat |
43960282 |
T |
 |
| Q |
215 |
tttaaaatcaag-nnnnnnnactnnnnnnnncaattttcatatcatcaagctctatcttattgcct |
279 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43960281 |
tttaaaatcaagttttttttactaaaaaaaacaattttcatatcatcaagctctatcttattgcct |
43960216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University