View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15807_high_3 (Length: 242)
Name: NF15807_high_3
Description: NF15807
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15807_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 83 - 226
Target Start/End: Complemental strand, 55309212 - 55309069
Alignment:
| Q |
83 |
gttagattatatttgataaaccacataaaatcgctgtgtgcattcttcttctgtgttcttctatagtttctgtttactcttgtttctatcttaacaatag |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55309212 |
gttagattatatttgataaaccacataaaatcgttgtgtgcattcttcttctgtgttcttctatagtttctgtttactcttgtttctatcttaacaatag |
55309113 |
T |
 |
| Q |
183 |
tttacagaacaaactgatttagctatagttatcactttcctatg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55309112 |
tttacagaacaaactgatttagctatagttatcactttcctatg |
55309069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 24 - 86
Target Start/End: Complemental strand, 55309435 - 55309373
Alignment:
| Q |
24 |
tggatatgtatgccacattcactgtcaatctaaacatgcacttatagacactttgttaagtta |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55309435 |
tggatatgtatgccacattcactgtcaatctaaacatgcacttatagacactttgttaagtta |
55309373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University