View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15808_high_14 (Length: 221)
Name: NF15808_high_14
Description: NF15808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15808_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 210
Target Start/End: Original strand, 46788423 - 46788615
Alignment:
| Q |
18 |
ggaacgatttgatttttataccccctggaaaaagcccctttaaacatatacaagaaattaatgcttaattctctgggagcaaacttaagctaaccatagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
46788423 |
ggaacgatttgatttttataccccctggaaaaagccactttcaacatatacaagaaattaatgcttaattctctgggagcaaactcaatctaaccatagt |
46788522 |
T |
|
| Q |
118 |
aatagttttatgtggttttcttgagcaaattggatgtttttgttgagatgtcatgacctctcccttgcattactttcttttcttttcttctca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46788523 |
aatagttttatgtggttttcttgagcaaattggatgttattgttgagatgtcatgacctctcccttgcattagattcttttcttttcttctca |
46788615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 23 - 163
Target Start/End: Original strand, 46781025 - 46781165
Alignment:
| Q |
23 |
gatttgatttttataccccctggaaaaagcccctttaaacatatacaagaaattaatgcttaattctctgggagcaaacttaagctaaccatagtaatag |
122 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | | ||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46781025 |
gatttgatttttattccccctggaaaaagccgttctcaacatatacaagaaattaaggtttaattccgcgggagcaaacttaagctaaccatagtaatag |
46781124 |
T |
|
| Q |
123 |
ttttatgtggttttcttgagcaaattggatgtttttgttga |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46781125 |
ttttatgtggttttcttgagcaaattggatgttattgttga |
46781165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 161 - 210
Target Start/End: Original strand, 46781184 - 46781233
Alignment:
| Q |
161 |
tgagatgtcatgacctctcccttgcattactttcttttcttttcttctca |
210 |
Q |
| |
|
|||||||||| |||| |||||||||| || ||||| |||||||||||||| |
|
|
| T |
46781184 |
tgagatgtcaggaccactcccttgcaatagtttctcttcttttcttctca |
46781233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University