View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15808_low_10 (Length: 315)
Name: NF15808_low_10
Description: NF15808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15808_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 27 - 214
Target Start/End: Original strand, 7609910 - 7610096
Alignment:
| Q |
27 |
tcgttgacggtaaccactgaatttgttcttgttggtggtgatgtgcttgatcgatgaaattgtttctagaaaagaattataactcaacttatcacaaaga |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7609910 |
tcgttgacggtaaccactgaatttgttcttgttggtggtgatgtgcttgatcgatgaaattgtttctagaaaagaattataactcaacttatcacaaaga |
7610009 |
T |
 |
| Q |
127 |
agctaaccacattttcttttcctctttagtcttccaaagggagaattatgtggaagttttttattgctagcttcattcacacctagga |
214 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7610010 |
agctaaccacattttcatttcctc-ttagtcttccaaagggagaattatgtggaagttttttattgctagcttcattcacacctagga |
7610096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University