View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15808_low_11 (Length: 291)
Name: NF15808_low_11
Description: NF15808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15808_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 15 - 173
Target Start/End: Original strand, 20998058 - 20998216
Alignment:
| Q |
15 |
aaacaaaaataaaggagaaatttctgcaatatatttatatatggtcttattgtttc-cagagtattgagaaattgcaatatcagtggaacattgcccgaa |
113 |
Q |
| |
|
||||||||||| |||||||||||| |||| |||||||| ||||||||| ||| || |||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
20998058 |
aaacaaaaatagaggagaaatttc-gcaaaatatttatgtatggtcttgttggctcgcagagtattgagaagttgcaatatcagtggagcattgcccgaa |
20998156 |
T |
 |
| Q |
114 |
tatcttggaaagttaactaatctgaaagtgatgtaagtatagttatacttcttttcattt |
173 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
20998157 |
tatcttggaaagttaactaatctggaagtgatgtaagtatagttatgcttctttccattt |
20998216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 15 - 173
Target Start/End: Complemental strand, 21013305 - 21013147
Alignment:
| Q |
15 |
aaacaaaaataaaggagaaatttctgcaatatatttatatatggtcttattgtttc-cagagtattgagaaattgcaatatcagtggaacattgcccgaa |
113 |
Q |
| |
|
||||||||||| |||||||||||| |||| |||||||| ||||||||| ||| || |||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
21013305 |
aaacaaaaatagaggagaaatttc-gcaaaatatttatgtatggtcttgttggctcgcagagtattgagaagttgcaatatcagtggagcattgcccgaa |
21013207 |
T |
 |
| Q |
114 |
tatcttggaaagttaactaatctgaaagtgatgtaagtatagttatacttcttttcattt |
173 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
21013206 |
tatcttggaaagttaactaatctggaagtgatgtaagtatagttatgcttctttccattt |
21013147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University