View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15808_low_14 (Length: 228)
Name: NF15808_low_14
Description: NF15808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15808_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 19 - 124
Target Start/End: Original strand, 30769464 - 30769569
Alignment:
| Q |
19 |
cagagaagctagtaacgtggaaactcaggattttaacaagatttatgcagaatttcaacatgaaacaaattcattgtaataggctagtagtaataagtta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769464 |
cagagaagctagtaacgtggaaactcaggattttaacaagatttatgcagaatttcaacatgaaacaaattcattgtaataggctagtagtaataagtta |
30769563 |
T |
 |
| Q |
119 |
ataggt |
124 |
Q |
| |
|
| |||| |
|
|
| T |
30769564 |
agaggt |
30769569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 151 - 209
Target Start/End: Original strand, 30769596 - 30769654
Alignment:
| Q |
151 |
cattggactatatgaaaagatatcacatgggtgtgggagggtaaaggtaccttggcttg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769596 |
cattggactatatgaaaagatatcacatgggtgtgggagggtaaaggtaccttggcttg |
30769654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University