View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15809_high_3 (Length: 276)
Name: NF15809_high_3
Description: NF15809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15809_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 16 - 269
Target Start/End: Complemental strand, 5391215 - 5390961
Alignment:
| Q |
16 |
gaaaccaatcatggcgcaggacgagcgtgaatcatctattgccgatgacgataacagaattccgaaatacaagggaatttctgtgaataaaaggaactgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5391215 |
gaaaccaatcatggcgcaggacgagcgtgaatcatctattgccgatgacgataacagaattccgaaatacaagggaatttctgtgaataaaaggaactgt |
5391116 |
T |
 |
| Q |
116 |
gttaaaaatgaacctgattcatctttcattgatcattctgcagcattttctggtactttattt-ttcaattatattgtttttgaataagttttctcaatt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5391115 |
gttaaaaatgaacctgattcatctttcattgatcattctgcagcattttctggtactttatttattcaattatattgtttttgaataagttttctcaatt |
5391016 |
T |
 |
| Q |
215 |
accgagttcaattccaatcaaatgtgtctgatgaataaggaatattcctatgctt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5391015 |
accgagttcaattccaatcaaatgtgtctgatgaataaggaatattcctatgctt |
5390961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University