View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15809_low_4 (Length: 259)

Name: NF15809_low_4
Description: NF15809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15809_low_4
NF15809_low_4
[»] scaffold0217 (1 HSPs)
scaffold0217 (2-243)||(5883-6120)


Alignment Details
Target: scaffold0217 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: scaffold0217
Description:

Target: scaffold0217; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 2 - 243
Target Start/End: Original strand, 5883 - 6120
Alignment:
2 agaagatcctaaggcagctctggtagatgatatgtaagggttctatgtcttgcctacttttactaattttcaaaatctaagccctgaataactgtatgtt 101  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||    
5883 agaagatcctaaggcagctctggtagatgatatgtaagggttctatgtc----ctacttttactaattttcaaaatctaagccctgaataactgtatgtt 5978  T
102 agaagagatttgtatgagaacccaaccttggaagtttttaagagtgaaatcaaagaggaattagctgctcagaggcagaaaaaagaagctctagaagctc 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5979 agaagagatttgtatgagaacccaaccttggaagtttttaagagtgaaatcaaagaggaattagctgctcagaggcagaaaaaagaagctctagaagctc 6078  T
202 aaatgggtagcattatggtatatcaagaagcatgcaaaatca 243  Q
    |||||||||||||||||||||||  |||||||||||||||||    
6079 aaatgggtagcattatggtatatatagaagcatgcaaaatca 6120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University