View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15809_low_4 (Length: 259)
Name: NF15809_low_4
Description: NF15809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15809_low_4 |
 |  |
|
| [»] scaffold0217 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0217 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: scaffold0217
Description:
Target: scaffold0217; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 2 - 243
Target Start/End: Original strand, 5883 - 6120
Alignment:
| Q |
2 |
agaagatcctaaggcagctctggtagatgatatgtaagggttctatgtcttgcctacttttactaattttcaaaatctaagccctgaataactgtatgtt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5883 |
agaagatcctaaggcagctctggtagatgatatgtaagggttctatgtc----ctacttttactaattttcaaaatctaagccctgaataactgtatgtt |
5978 |
T |
 |
| Q |
102 |
agaagagatttgtatgagaacccaaccttggaagtttttaagagtgaaatcaaagaggaattagctgctcagaggcagaaaaaagaagctctagaagctc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5979 |
agaagagatttgtatgagaacccaaccttggaagtttttaagagtgaaatcaaagaggaattagctgctcagaggcagaaaaaagaagctctagaagctc |
6078 |
T |
 |
| Q |
202 |
aaatgggtagcattatggtatatcaagaagcatgcaaaatca |
243 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6079 |
aaatgggtagcattatggtatatatagaagcatgcaaaatca |
6120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University