View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1580_high_19 (Length: 339)
Name: NF1580_high_19
Description: NF1580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1580_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 34379517 - 34379206
Alignment:
| Q |
1 |
tgagaaagtttgatatggggtttgaggtgaggattggagaagtatcaccattggcaatacggttaatataattttgaatatcttcataggttatgatagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34379517 |
tgagaaagtttgatatggggtttgaggtgaggattggagaagtatcaccattggcaataaggttaatatcattttgaatatcttcataggttatgatagg |
34379418 |
T |
|
| Q |
101 |
gagaagtttcttgaaagtttcactatctgtatggccattgagaccatgtctttgcaaatattcaacatttgcattgcggttgaggatttcagctaggacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34379417 |
gagaagtttcttgaaagtttcactatctgtatggccattgagaccatgtctttgcaaatattcaacatttgcattgcggttgaggatttcagctaggacc |
34379318 |
T |
|
| Q |
201 |
nnnnnnnggatttcatctgcatgtgtagtaatatcctctatgaaatcaagagttttcttgnnnnnnngggagagatcataatcaagagaagtaggcatgg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34379317 |
tttttttggatttcatctgcatgtgtagtaatatcctctatgaaatcaagagttttcttgtttttttgggagagatcataatcaagagaagtaggcatgg |
34379218 |
T |
|
| Q |
301 |
ttaataagggtg |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34379217 |
ttaataagggtg |
34379206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University