View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1580_high_47 (Length: 225)
Name: NF1580_high_47
Description: NF1580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1580_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 10 - 209
Target Start/End: Original strand, 23989132 - 23989331
Alignment:
| Q |
10 |
agattattctttgtttaaaattgttcttcgttgcttattatggttatgataattaatgatgatgtggtctcattaacttattannnnnnnnatgtgtaga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23989132 |
agattattctttgtttaaaattgttcttcgttgcttattatggttatgataattaatgatgatgtggtctcattaacttattattatttttatgtgtaga |
23989231 |
T |
 |
| Q |
110 |
attcggttgagaatcagaagaatggagatatgcatgaggatcagttgtatgatgattcacctgagcatcaacagaatgaatatgaggatgatcagatgag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23989232 |
attcggttgagaatcagaagaatggagatacgcatgaggatcagttgtatgatgattcacctgagcatcaacagaatgaatatgaggatgatcagatgag |
23989331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 101 - 209
Target Start/End: Original strand, 23982442 - 23982553
Alignment:
| Q |
101 |
atgtgtagaattcggttgagaatcagaagaatggagatatgcatgaggatcagttgtatgatgattc---acctgagcatcaacagaatgaatatgagga |
197 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
23982442 |
atgtgtagaattcggttgtgaatctgaagaatggggatatgcatgaggatcagttgtatgatgattcagtacctgagcatcaacagaatgaagatgagga |
23982541 |
T |
 |
| Q |
198 |
tgatcagatgag |
209 |
Q |
| |
|
|||||||||||| |
|
|
| T |
23982542 |
tgatcagatgag |
23982553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University