View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1580_high_51 (Length: 221)
Name: NF1580_high_51
Description: NF1580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1580_high_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 81 - 208
Target Start/End: Original strand, 45340495 - 45340622
Alignment:
| Q |
81 |
ggaaaaccttattaggggtgctaaaactatcatatatgagatttagcaacatttttcaaatgttactaaccnnnnnnntactacttaacatttaataaca |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45340495 |
ggaaaaccttattaggggtgctaaaactatcatatatgagatttagcaacatttttcaaatgttactaaccaaaaaattactacttaacatttaataaca |
45340594 |
T |
|
| Q |
181 |
tttgaaaatgttaggcaaaacctatgct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
45340595 |
tttgaaaatgttaggcaaaacctatgct |
45340622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 17 - 58
Target Start/End: Original strand, 45340431 - 45340472
Alignment:
| Q |
17 |
cacttttcatcagaaatattggtgctacaaacccatcttttc |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45340431 |
cacttttcatcagaaatattggtgctacaaacccatcttttc |
45340472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University