View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1580_low_12 (Length: 429)
Name: NF1580_low_12
Description: NF1580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1580_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 11 - 413
Target Start/End: Complemental strand, 5228527 - 5228132
Alignment:
| Q |
11 |
cacagacccacagacacaataataaaatcaaccctagcatgtgaaactctttttgcattgttaaactctccatcatcaaaactcttgaatagctgaataa |
110 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5228527 |
cacaaacccacaaacacaataataaaatcaaccccagcatgtgaaactctttttgcattgttaaactctccatcatcaaaactcttgaatagctgaat-- |
5228430 |
T |
 |
| Q |
111 |
ttgattcagctatttttctcaacccaacaatggtgtgtcttttgctgccttcacttctatttgataatttgatatttataagagtaaaaaggtgaataag |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5228429 |
-----tcagctatttttctcaacccaacaatggtgtgtcttttgctgccttcacttctatttgataatatgatatttataagagtaaaaaggtgaataag |
5228335 |
T |
 |
| Q |
211 |
ggactaagagaaaacggcttctagtttttgtttgtggacagatgttactttttgagagatagaatgttttgttacaaggtgaggtgtgtgcatttgatgg |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5228334 |
ggactaagagaaaacggcttctagtttttgtttgtggacagatgttactttttgagagatagaatgttttgttacaaggtgaggtgtgtgcttttgatgg |
5228235 |
T |
 |
| Q |
311 |
gtgtgctgaggtgaagggaatgcaaatgaaagtgctttttgtagatttggaaaacgatgggaagagaannnnnnnntgtcattatgtgactcattgctct |
410 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
5228234 |
gtgagctgaggtgaagggaatgcaaatgaaagtgctttttgtagatttggaaaacgatgggaagagaaggggggagtgtcattatgtgactcgttgctct |
5228135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University