View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1580_low_54 (Length: 224)
Name: NF1580_low_54
Description: NF1580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1580_low_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 31762509 - 31762308
Alignment:
| Q |
1 |
atgctgttatagaaattaaaactatacctcaatgattatgagtagaagtgtgtgatgaagggtcttcaatgtttgctctgttccgaggtttagaaaagtg |
100 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31762509 |
atgctgttatagaaaataaaaccatacctcaatgattatgagtagaagtgtttgatgaagggtcttcaatgtttgctctgttctgaggtttagaaaagtg |
31762410 |
T |
|
| Q |
101 |
gagtgtttttgcagtgttgtgttgtgaagagtaacataagagaagtggggtttttggttttaccctttggtagatggatacagaaatgacacagctggaa |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31762409 |
gagtgtttttgcagtgttttgttgtgaagagtaacataagagaagtggggtttttggttttaccctttggtggatggatacagaaatgacacagctggaa |
31762310 |
T |
|
| Q |
201 |
ga |
202 |
Q |
| |
|
|| |
|
|
| T |
31762309 |
ga |
31762308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University