View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1580_low_56 (Length: 221)

Name: NF1580_low_56
Description: NF1580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1580_low_56
NF1580_low_56
[»] chr2 (2 HSPs)
chr2 (81-208)||(45340495-45340622)
chr2 (17-58)||(45340431-45340472)


Alignment Details
Target: chr2 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 81 - 208
Target Start/End: Original strand, 45340495 - 45340622
Alignment:
81 ggaaaaccttattaggggtgctaaaactatcatatatgagatttagcaacatttttcaaatgttactaaccnnnnnnntactacttaacatttaataaca 180  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||    
45340495 ggaaaaccttattaggggtgctaaaactatcatatatgagatttagcaacatttttcaaatgttactaaccaaaaaattactacttaacatttaataaca 45340594  T
181 tttgaaaatgttaggcaaaacctatgct 208  Q
    ||||||||||||||||||||||||||||    
45340595 tttgaaaatgttaggcaaaacctatgct 45340622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 17 - 58
Target Start/End: Original strand, 45340431 - 45340472
Alignment:
17 cacttttcatcagaaatattggtgctacaaacccatcttttc 58  Q
    ||||||||||||||||||||||||||||||||||||||||||    
45340431 cacttttcatcagaaatattggtgctacaaacccatcttttc 45340472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University