View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1581-INSERTION-6 (Length: 388)
Name: NF1581-INSERTION-6
Description: NF1581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1581-INSERTION-6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 7 - 278
Target Start/End: Complemental strand, 50407386 - 50407116
Alignment:
| Q |
7 |
aataaacctttacttaattagttaatttgaaatccttaaataatgccacacgaaactcgttaacaaaatccatcttttatgagcctaattatgatgaaaa |
106 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50407386 |
aataaacctttacttagttagttaatttgaaatccttaaataatgccacacgaaactcgttaacaaaatccatcttttatgaacctaattatgatgaaaa |
50407287 |
T |
|
| Q |
107 |
agctaagcaagtgtaatacttagttggttatttgcttaacataaaatggtgatgtggcactttattattcttgtaggattaggcagcattgattaaaaca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
50407286 |
agctaagcaagtgtaatacttagttggttatttgcttaacataaaatggtggtgtggcactttattattcttttaggattaggcagcattgattgaaaca |
50407187 |
T |
|
| Q |
207 |
gttcttctagagagaggcaaccatccaccaaggaggaagttatactagtgtctccgtgaaccttcttcctcc |
278 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50407186 |
gttcttctagagagaggcaacca-ccaccaaggaggaagttatactagtgtctccgtgaaccttcttcctcc |
50407116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 311 - 388
Target Start/End: Complemental strand, 50407085 - 50407008
Alignment:
| Q |
311 |
ctaattggagttcgactttgtttaactccatataatctgtttgcattatcacagcttgtgtgcagtaccttggtatat |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50407085 |
ctaattggagttcgactttgtttaactccatataatctgtttgcattatcacagcttgtgtgcagtaccttggtatat |
50407008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University