View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1581-INSERTION-7 (Length: 350)
Name: NF1581-INSERTION-7
Description: NF1581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1581-INSERTION-7 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 34 - 350
Target Start/End: Original strand, 3078189 - 3078503
Alignment:
| Q |
34 |
gaacaccccctctccacttggcatcccaaaacttggtatgagccccatttctcacctttctagcaacctcttcattaaaccaatacgacccatctcttcc |
133 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3078189 |
gaacaccccctctccacttcgcatcccaaaacttggtatgagccccatttctcacctttctagcaacctctttattaaaccaatacgacccatctcttcc |
3078288 |
T |
|
| Q |
134 |
ttcaatactaactaaatccttccaccatcttgaggaattcgatgggcaactcgcgattcctccttccaacaaaccacaaacatttgaaccatatatttct |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
3078289 |
ttcaatactaactaaatccttccaccatcttgaggaattcgatgggcaactcgcgattcctccttccaacaaaccacaaacattcgaacc--atatttct |
3078386 |
T |
|
| Q |
234 |
ttattaggacctccttccaaagcaaaattctctattcgaaccatattgctttgttggttgaaccaaagtattcaaacttccatggagttgtatctttcaa |
333 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3078387 |
ctattagaacctccttccaaagcatatttctctattcgaaccatattgctttgttggttgaaccaaagtattcaaacttccatggagttgtatctttcaa |
3078486 |
T |
|
| Q |
334 |
actattattatcgttta |
350 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
3078487 |
actgttattatcgttta |
3078503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12083 times since January 2019
Visitors: 1123