View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15810_low_6 (Length: 213)
Name: NF15810_low_6
Description: NF15810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15810_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 53 - 190
Target Start/End: Complemental strand, 39952927 - 39952790
Alignment:
| Q |
53 |
tagttaagttagatgctagctttctcatcaatatatcactaaaataatagacacatccatgtcacattatcagatatatccaaacttttagtctttccca |
152 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39952927 |
tagttaagttagatgctagctttcacatcaatatatcactaaaataatagacacatccatgtcacattatcagatatatccaaacttttagtctttccca |
39952828 |
T |
 |
| Q |
153 |
aatatgttgcaagctatggtttctgatgttaaccatca |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39952827 |
aatatgttgcaagctatggtttctgatgttaaccatca |
39952790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 53 - 190
Target Start/End: Original strand, 50416814 - 50416954
Alignment:
| Q |
53 |
tagttaagttagatgctagctttctcatcaatatatcactaaaataata---gacacatccatgtcacattatcagatatatccaaacttttagtctttc |
149 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||| |||||| ||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
50416814 |
tagttaagttagatgctagctttcacatcaatataacactaaaataataaatgacacagccatgtcacgttatcagatatatgcaaacttttagtctttc |
50416913 |
T |
 |
| Q |
150 |
ccaaatatgttgcaagctatggtttctgatgttaaccatca |
190 |
Q |
| |
|
||| |||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
50416914 |
ccagatatgttgaaagcaatggtttctgatgttaaccatca |
50416954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University