View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15812_high_2 (Length: 304)
Name: NF15812_high_2
Description: NF15812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15812_high_2 |
 | |
|
| [»] scaffold0007 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 41 - 203
Target Start/End: Complemental strand, 149871 - 149709
Alignment:
| Q |
41 |
gtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccact |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149871 |
gtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccact |
149772 |
T |
|
| Q |
141 |
tgaaacatataatggagttgaaataaaagggtttgttccacttccacttacaacaatttgttg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149771 |
tgaaacatataatggagttgaaataaaagggtttgttccacttccacttacaacaatttgttg |
149709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 241 - 298
Target Start/End: Complemental strand, 149671 - 149614
Alignment:
| Q |
241 |
attggtcttgttgtttctgttatggattcttcatgttgtggttttggtgatgatgatg |
298 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149671 |
attggccttgttgtttctattatggattcttcatgttgtggttttggtgatgatgatg |
149614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University