View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15812_high_3 (Length: 300)
Name: NF15812_high_3
Description: NF15812
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15812_high_3 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 19 - 295
Target Start/End: Complemental strand, 150514 - 150238
Alignment:
| Q |
19 |
tgagaagatctcattcttgatcccataaactgtgaaagttcttcaaaaacttcttcatcaaaagaagctggtaacctatgcaactttctttcataaggtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
150514 |
tgagaagatctcattcttgatcccataaactgtgaaagttcttcaaaaacttcttcatcaaaagaagctggtaacctatgcaactttctttcataaggtg |
150415 |
T |
 |
| Q |
119 |
acagtctaaaatagcttttaccaacttgttctctttccccacctctttcccattcataaactttcctaaactcacctaacatgttatcccattttgtacc |
218 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
150414 |
aaagtctaaaatagcttttaccaacttgttctctttcaccacctctttcccattcataaactttcctaaactcacctaacatgttatcccattttgtacc |
150315 |
T |
 |
| Q |
219 |
tgctgtttttgcatctctattaacaccatgtttgtttagaaattcagctacttctttgtctttatcagctcttgttt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
150314 |
tgctgtttttgcatctctattaacaccatgtttgtttagaaattcagctacttctttgtctttatcagctcttgttt |
150238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University