View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15813_high_14 (Length: 248)
Name: NF15813_high_14
Description: NF15813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15813_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 11 - 204
Target Start/End: Complemental strand, 5885326 - 5885133
Alignment:
| Q |
11 |
catcatcatgagagttggaaggaggaggaagccaaacatattcaacaccagcatctgctatgtcagggaccttggtcttcaggaaattccaccatcctcc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5885326 |
catcatcatgagagttggaaggaggaggaagccaaacatattcaacaccagcatctgctatgtcagggaccttggtcttcaggaaattccaccatcctcc |
5885227 |
T |
 |
| Q |
111 |
ttctttttcacttgatgcccacttgaacccctacaacatgtacacatgtaattcatatcttttaaactctcttcctcactattagaaggaaaag |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5885226 |
ttctttttcacttgatgcccacttgaacccctacaacatgtacacatgtaattcatatcttttaaactctcttccccactattagaaggaaaag |
5885133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University