View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15813_low_10 (Length: 333)
Name: NF15813_low_10
Description: NF15813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15813_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 8 - 316
Target Start/End: Complemental strand, 26883641 - 26883333
Alignment:
| Q |
8 |
gacatcatcataaccattgtcgcctaattaacttatgatcaataggtacgacaaataactctacacgactcttgattgaagacaagatcatgattcataa |
107 |
Q |
| |
|
|||| |||||||||||| || |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26883641 |
gacagcatcataaccatcgttgcctaattaacttatgatcagtaggtacgacaaataactctacacgactcttgattgaagacaagatcatggttcataa |
26883542 |
T |
 |
| Q |
108 |
actctggagattctggcgcctgtcagcgtgtcttccctagagaggaacgacgatacattatgttgtcagaatccgatggtggggaattagtccctcctcc |
207 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26883541 |
actctggagattctagcgcccgtcggcgtgtcttccctagagaggaacgacgatacattatgttgtcagaatccgatggtggggaattactccctcctcc |
26883442 |
T |
 |
| Q |
208 |
ctcgtatcgtctagagtgattgtgggacgaacggtcatgcttttgtggtgttgtggatcttctcttttggagtcactttttctttatttttgtgtttatg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26883441 |
ctcgtatcgtctagagtgattgtgggacgaacggtcatgcttttgtggtgttgtggatcttctcttttggagtcactttttctttatttttgtgtttatg |
26883342 |
T |
 |
| Q |
308 |
gtaccttct |
316 |
Q |
| |
|
||||||||| |
|
|
| T |
26883341 |
gtaccttct |
26883333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University