View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15813_low_16 (Length: 248)

Name: NF15813_low_16
Description: NF15813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15813_low_16
NF15813_low_16
[»] chr1 (1 HSPs)
chr1 (11-204)||(5885133-5885326)


Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 11 - 204
Target Start/End: Complemental strand, 5885326 - 5885133
Alignment:
11 catcatcatgagagttggaaggaggaggaagccaaacatattcaacaccagcatctgctatgtcagggaccttggtcttcaggaaattccaccatcctcc 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5885326 catcatcatgagagttggaaggaggaggaagccaaacatattcaacaccagcatctgctatgtcagggaccttggtcttcaggaaattccaccatcctcc 5885227  T
111 ttctttttcacttgatgcccacttgaacccctacaacatgtacacatgtaattcatatcttttaaactctcttcctcactattagaaggaaaag 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
5885226 ttctttttcacttgatgcccacttgaacccctacaacatgtacacatgtaattcatatcttttaaactctcttccccactattagaaggaaaag 5885133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University