View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15813_low_17 (Length: 244)
Name: NF15813_low_17
Description: NF15813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15813_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 111 - 234
Target Start/End: Complemental strand, 46760040 - 46759918
Alignment:
| Q |
111 |
gtaagaggggggaaaaataacaatagagtatctcatttaggagtacaaattttatatggagcaatgtgacgtttgattccatagattgatgataggtatg |
210 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46760040 |
gtaagagggggaaaaaataacaatagagtttctcatttaggagtataa-ttttatatgaagcaatgtgacgtttgattccatagattgatgataggtatg |
46759942 |
T |
|
| Q |
211 |
gtgccagtggatgctttgcctttg |
234 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
46759941 |
gtgccagtggatgctttgcctttg |
46759918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University