View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15813_low_17 (Length: 244)

Name: NF15813_low_17
Description: NF15813
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15813_low_17
NF15813_low_17
[»] chr1 (1 HSPs)
chr1 (111-234)||(46759918-46760040)


Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 111 - 234
Target Start/End: Complemental strand, 46760040 - 46759918
Alignment:
111 gtaagaggggggaaaaataacaatagagtatctcatttaggagtacaaattttatatggagcaatgtgacgtttgattccatagattgatgataggtatg 210  Q
    ||||||||||| ||||||||||||||||| ||||||||||||||| || ||||||||| |||||||||||||||||||||||||||||||||||||||||    
46760040 gtaagagggggaaaaaataacaatagagtttctcatttaggagtataa-ttttatatgaagcaatgtgacgtttgattccatagattgatgataggtatg 46759942  T
211 gtgccagtggatgctttgcctttg 234  Q
    ||||||||||||||||||||||||    
46759941 gtgccagtggatgctttgcctttg 46759918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University