View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15814_low_17 (Length: 248)
Name: NF15814_low_17
Description: NF15814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15814_low_17 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 45120765 - 45120518
Alignment:
| Q |
1 |
atcattcataatcttgtagttatgtacacggttcacctttgcttgaaagctctagcgcatttgaatcacaggattctgcagaaagaatatcagcagccct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45120765 |
atcattcataatcttgtagttatgtacacggttcacctttgcttgaaagctctagcgcatttgaatcacaggattctgcagaaagaatatcagcagctct |
45120666 |
T |
|
| Q |
101 |
tggcagggtaatgatgttagatcttgttatcagaaatgaagacaggcttccatgccgtcaacttaggtggcgtgggaaccctgcaaatttgttattggcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45120665 |
tggcagggtaatgatgttagatcttgttatcagaaatgaagacaggcttccatgccgtcaacttaggtggcgtgggaaccctgcaaatttgttattggcc |
45120566 |
T |
|
| Q |
201 |
gaaaagacaatctcttcaaatttagataaaataggagatgcctttgat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45120565 |
gaaaagacaatctcttcaaatttagataaaataggagatgcctttgat |
45120518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 40255931 - 40255742
Alignment:
| Q |
18 |
agttatgtacacggttcacctttgcttgaaagctctagcgcatttgaatcacaggattctgcagaaagaatatcagcagcccttggcagggtaatgatgt |
117 |
Q |
| |
|
|||||||| || ||||| ||||||||||||| | |||| || ||||| |||| ||| |||||||||| || ||||| ||| ||||||| |||| ||||| |
|
|
| T |
40255931 |
agttatgttcatggttcgcctttgcttgaaaacactagtgcctttgagtcacgggaatctgcagaaaaaacatcagaagctcttggcaaggtattgatgc |
40255832 |
T |
|
| Q |
118 |
tagatcttgttatcagaaatgaagacaggcttccatgccgtcaacttaggtggcgtgggaaccctgcaaatttgttattggccgaaaaga |
207 |
Q |
| |
|
| || | || ||| |||||||||| ||||| || |||||| | ||||||||||| ||||| ||||||||||||| ||||| ||||||| |
|
|
| T |
40255831 |
tggacttggtcatccgaaatgaagataggctcccttgccgtgagcttaggtggcgcgggaattctgcaaatttgttgttggctgaaaaga |
40255742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University