View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15814_low_21 (Length: 234)
Name: NF15814_low_21
Description: NF15814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15814_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 18395492 - 18395289
Alignment:
| Q |
15 |
aaaatcaaagaccaagacaattgatttaaattgaagatactattttcaagtatgtgataaaatagctggatcaaaagtagaattaagnnnnnnnnntaca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
18395492 |
aaaatcaaagaccaagacaattgatttaaattgaagatattactttcaagcatgtgataaaataactggatcaaaagtagaattaagaaaaaaaa-taca |
18395394 |
T |
|
| Q |
115 |
aataaaatgccagagtccttatcgatttatcacatgaaggtggaatcccagctatacaaaacctaccaataattatattatannnnnnngacaataacaa |
214 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18395393 |
aataatatgccagagtccttatcgatttatcacatgaaggtggaatcccagctatccaaaacctaccaataattatattatatttttttgacaataacaa |
18395294 |
T |
|
| Q |
215 |
taatt |
219 |
Q |
| |
|
||||| |
|
|
| T |
18395293 |
taatt |
18395289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University