View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15814_low_24 (Length: 217)
Name: NF15814_low_24
Description: NF15814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15814_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 13 - 193
Target Start/End: Complemental strand, 39489893 - 39489715
Alignment:
| Q |
13 |
caaagggagagaaatatgaactttatggctctgtttattagttgctaaattttcaataaaagataaattacgaatttggaccaattttttgtatttcaag |
112 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39489893 |
caaaaggagagaaatatgaacttt--ggctctgtttattagttgctaaattttcaataaaagataaattacgaatttggaccaatcgtttgtatttcaag |
39489796 |
T |
 |
| Q |
113 |
ctcattgtcgcttctttaaatgaactgcatcctatgaaatttcaagtttttctgtgctttgatttgaaaaatgaaataaaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39489795 |
ctcattgtcgcttctttaaatgaactgcatcctatgaaatttcaagttgttctgtgctttgatttgaaaaatgaaataaaa |
39489715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 139 - 198
Target Start/End: Complemental strand, 39483904 - 39483845
Alignment:
| Q |
139 |
gcatcctatgaaatttcaagtttttctgtgctttgatttgaaaaatgaaataaaactcca |
198 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39483904 |
gcatcctatgaaatttcaagtagttctatgctttgatttgaaaaatgaaataaaactcca |
39483845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University