View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15814_low_8 (Length: 437)
Name: NF15814_low_8
Description: NF15814
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15814_low_8 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 97 - 437
Target Start/End: Complemental strand, 30770726 - 30770386
Alignment:
| Q |
97 |
gagtaatgttacacaaagcataaccaaccataccttgtaactgaatctggtgaaggaagactcacaccaccactagtccttggttgaccaagctgcaatg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
30770726 |
gagtaatgttacacaaagcataaccaaccataccttgtaactgaatctggtgatggaagactcacaccaccactagtccttggttgaacaagctgcaacg |
30770627 |
T |
 |
| Q |
197 |
gcaaaggcggttttcgagatccgattaatcctccataatctgatctctcatcatcagaaacaaccctattcacattaacatcaccactagtagcagcaac |
296 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30770626 |
gtaaaggaggttttcgagatccgattaatcctccataatctgatctctcatcatcagaaacaaccctattcacattaacatcaccactagtagcagtaac |
30770527 |
T |
 |
| Q |
297 |
aactccaccaaaagccattgttgatgttgcaggaattgcagccatagccacattagcagaagaaacaacaaacccaccatcttgcttcattacaactttg |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30770526 |
aactccaccaaaagccattgttgatgttgcaggaattgcagccatagccacattagcagaagaaacaacaaacccaccatcttgcttcattacaactttg |
30770427 |
T |
 |
| Q |
397 |
ttctcttgttgaagcctgctaccagcattttcgtcgacacg |
437 |
Q |
| |
|
||||||||||||||||||||||| |||||||| || ||||| |
|
|
| T |
30770426 |
ttctcttgttgaagcctgctaccggcattttcatcaacacg |
30770386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University