View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15816_high_13 (Length: 326)
Name: NF15816_high_13
Description: NF15816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15816_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 32 - 295
Target Start/End: Original strand, 2467765 - 2468028
Alignment:
| Q |
32 |
ctcacttatatcctcttccattttcccccctcctactcctcgctgcaatctcaaattaccaccacgctttcaattcgccaacatttttcgggctacaacg |
131 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
2467765 |
ctcacttatatcctcttccatttttccccctcctactcctcgctgcaatctcaaattaccaccacgctttcaattcaccaacatttttcggtctacaacg |
2467864 |
T |
|
| Q |
132 |
gtaatttcctgaacctatcttcaacttcatttcattcaattcaatgcctcaaatttactttcattttcgtatagggattcgttcgtgcttccgaggatga |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467865 |
gtaatttcctgaacctatcttcaacttcatttcattcaattcaatgcctcaaatttattttcattttcgtatagggattcgttcgtgcttccgaggatga |
2467964 |
T |
|
| Q |
232 |
ctttgttgccgaaaattccgattctcaatgccaattggcaacacagaatgtgtcttctgatgat |
295 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467965 |
ctctgttgccgaaaattccgattctcaatgccaattggcaacacagaatgtgtcttctgatgat |
2468028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University