View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15816_high_4 (Length: 428)
Name: NF15816_high_4
Description: NF15816
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15816_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 29 - 343
Target Start/End: Original strand, 33647263 - 33647577
Alignment:
| Q |
29 |
ggaataacacaaccactgtagtttgaagcactacaatcttgtacgaggaacgtgttgttccatgttggagcatagtttttgtcgaaaagttggtttatga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33647263 |
ggaataacacaaccactgtagtttgaagcactacaatcttgtacgaggaacgtgttgttccatgttggagcatagtttttgtcgaaaagttggtttatga |
33647362 |
T |
|
| Q |
129 |
aacttatgctacggttacattttgctggtaaagatatgaatatactatcagaattcacttcttgaacttttagttccccaatcttgagttctttattgat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
33647363 |
aacttatgctacggttacattttgctggtaaagatatgaatatactatcagaattcacttcttgaactttcagttcaccaatcttgagttctttattgat |
33647462 |
T |
|
| Q |
229 |
gctacagtttagtttgatttcacaaccttcggaaaatccaaatggatacttaacagattgttttccacatctttgaacacagttagttttgttttgttca |
328 |
Q |
| |
|
||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33647463 |
gctgcagtttagtttgattttacaaccttcggaaaatccaaatggatacttaacagattgttttccacatctttgaacacagtcagttttgttttgttca |
33647562 |
T |
|
| Q |
329 |
gcagttgttactgtt |
343 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33647563 |
gcagttgttactgtt |
33647577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University