View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1581_high_1 (Length: 412)
Name: NF1581_high_1
Description: NF1581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1581_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 1e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 58 - 140
Target Start/End: Original strand, 27985981 - 27986063
Alignment:
| Q |
58 |
caaacttctcttgtgcagtgtttgggaatatgcagtggaagttcgaacttcaaattctagaagatcttgccccagttcctttt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
27985981 |
caaacttctcttgtgcagtgtttgggaatgtgtagtggaagttcgaatttcaaattctagaagatcttgccctagttcctttt |
27986063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 14 - 64
Target Start/End: Original strand, 27985899 - 27985949
Alignment:
| Q |
14 |
agaaggtggtgctggtggatatattgtcattctcatgtctcacacaaactt |
64 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27985899 |
agaaggtggtgctggtgtatatattgtcattctcatgtctcacacaaactt |
27985949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University