View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15820_low_3 (Length: 247)
Name: NF15820_low_3
Description: NF15820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15820_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 17141147 - 17141243
Alignment:
| Q |
1 |
ttttcctttgtcatcattgactctcttgagctatggaaaaccgatacaaatacggatatcaaacacaatacttacacagagacattagtaatacttt |
97 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17141147 |
ttttcctttgtcatcattggctctcttgagctattgaaaaccgatacaaatacagatatcaaacacaatacttacacagagacattagtaatacttt |
17141243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 150 - 240
Target Start/End: Original strand, 17141334 - 17141424
Alignment:
| Q |
150 |
acatgagtttgtgtcggtgtcaatgttatgttggtatttgacattaacatatgtcaaatatcaaacacacctttgatctgagttgtctgtg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
17141334 |
acatgagtttgtgtcggtgtcaatgttatgttggtatttgatattaacatatgtcaaatatcaaacacatctttgatctgagttgtttgtg |
17141424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University