View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15821_high_14 (Length: 253)
Name: NF15821_high_14
Description: NF15821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15821_high_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 16 - 253
Target Start/End: Complemental strand, 45512564 - 45512327
Alignment:
| Q |
16 |
cttcttctcgcgaccaagatggttggtgacaaggattcatgagatcaagtttgacaacatgtctagtaacattgtcacaaccaatgccttcccattggca |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512564 |
cttcttctcgcgaccaaaatggttggtgacaaggattcatgagatcaagtttgacaacatgtctagtaacattgtcacaaccaatgccttcccattggca |
45512465 |
T |
 |
| Q |
116 |
acagtgagtgcctttccatgatgaaagcttgtttggtgaatcatgtgcaatggatgctttgaaattgagaagggcttgcctctctttttcaatacagggg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512464 |
acagtgagtgcctttccatgatgaaagcttgtttggtgaatcatgtgcaatggatgctttgaaattgagaagggcttgcctctctttttcaatacagggg |
45512365 |
T |
 |
| Q |
216 |
atgtttgaatttacacacaagcatatttgtgcaatttc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512364 |
atgtttgaatttacacacaagcatatttgtgcaatttc |
45512327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University