View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15822_high_13 (Length: 255)
Name: NF15822_high_13
Description: NF15822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15822_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 18785435 - 18785527
Alignment:
| Q |
1 |
tgaagacgaatgtaagtccagtaacacatctttagcatataagtgacaatgtttgaactttgtgtatattttgtgaaatggtgtgtggcgatg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18785435 |
tgaagacgaatgtaagtccagtaacacatctatggcatataagtgacaatgtttgaactttgtgtatattttgtgaaattgtgtgtggcgatg |
18785527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 160 - 237
Target Start/End: Original strand, 18787706 - 18787783
Alignment:
| Q |
160 |
tctatgactgacattctcacccctttattggtgttgtgcttttctttgtggtggatgactgtacttttgtggtacaga |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
18787706 |
tctatgactgacattctcacccctttattggtgttgtgtttttctttgtggggggtgactgtacttttgtggtacaga |
18787783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 34635870 - 34635900
Alignment:
| Q |
1 |
tgaagacgaatgtaagtccagtaacacatct |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34635870 |
tgaagacgaatgtaagtccagtaacacatct |
34635900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University