View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15822_high_7 (Length: 324)
Name: NF15822_high_7
Description: NF15822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15822_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 308
Target Start/End: Complemental strand, 24773443 - 24773136
Alignment:
| Q |
1 |
aggataagcgttaaccattaaataagaaccggtttgacgtagaaactcgagcatcggtttaataactggttcaacaagttcggttttgaatgaaccggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| | |
|
|
| T |
24773443 |
aggataagcgttaaccattaaataagaaccggtttgacttagaaactcgagcatcggtttaataaccggttcaacaagttcagttttgaatgaaccggtt |
24773344 |
T |
 |
| Q |
101 |
gaggtagggtaagaagattgtaaagcagagagtgctatgggtgaagagattaaaatctgtttatctaggttttgtttttggagagaagcatgaacgtttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24773343 |
gaggtagggtaagaagattgtaaagcagagagagctattggtgaagagattaaaatctgtttatctaggttttgtttttggagagaagcatgaacgtttt |
24773244 |
T |
 |
| Q |
201 |
tcatggcgggtacgagatagttggtcgtgtttttcgggtctacgaaaacctcgtttccgacagaaatggcttcgatttgtgtggcggggtagtggttaag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24773243 |
tcatggcgggtacgagatagttggtcgtgtttttcgggtctacgaaaacctcgtttccgacagcaatggcttcgatttctgtggcggggtagtggttaag |
24773144 |
T |
 |
| Q |
301 |
gatgttgg |
308 |
Q |
| |
|
|||||||| |
|
|
| T |
24773143 |
gatgttgg |
24773136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University