View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15823_high_27 (Length: 369)
Name: NF15823_high_27
Description: NF15823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15823_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 18 - 349
Target Start/End: Original strand, 48670941 - 48671272
Alignment:
| Q |
18 |
ggaaactggttgagttcgttgtagaaacgatagtatatggagtaaagggtacaaggttgaatccaaagacaagcacatgggatattcaattcataagcca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48670941 |
ggaaactggttgagttcgttgtagaaacgatagtatatggagtaaagggtacaaggttgaatccaaagacaagcacatgggatattcaattcataagcca |
48671040 |
T |
|
| Q |
118 |
cgtttgctacccaaggaacaaaagggttattgataatgcaagctaattttttggaagggttgttgatgaaattgttatcgatgagatttgtgaggctaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48671041 |
cgtttgctacccaaggaacaaaagggttattgataatgcaagctaattttttggaagggttgttgatgaaattgttattgatgagatttgtgaggctaat |
48671140 |
T |
|
| Q |
218 |
gggaccgaatttggctatgagttccatgtattcatcagggcttttaaggccttgagatatgtcgaagccgtcggagaaaaacaggacgttgattccattg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48671141 |
gggaccgaatttggctatgagttccatgtattcatcagggcttttatggccttgagatatgtcgaagccgtcggagaaaaacaggacgttgattccattg |
48671240 |
T |
|
| Q |
318 |
gtggagtaagaagttgggacggtgtccgtgtc |
349 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| |
|
|
| T |
48671241 |
gtggagtaagaggttgggacggtgtctgtgtc |
48671272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University