View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15823_high_36 (Length: 292)
Name: NF15823_high_36
Description: NF15823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15823_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 274
Target Start/End: Complemental strand, 49831668 - 49831407
Alignment:
| Q |
12 |
caaaggaagataccgggggatgtcatgagagaaatagcaagataannnnnnnnnnnnnnnnnaaatagcaatggttgaaaatttgaaatgtaattaaaaa |
111 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49831668 |
caaaggaagataccaggggatgtcatgagagaaatagcaagataatttttttatttttttt-aaatagcaatggttgaaaatttgaaatgtaattaaaac |
49831570 |
T |
 |
| Q |
112 |
gacatttttgtctatttaaggcgtagatggaggtttatggggtgtaactaaaaacaaagccaaaagtattgatgtcttccatagcttgtttcttttttct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49831569 |
gacatttttgtctatttaaggcgtagatggaggtttatggggtgtaactaaaaacaaagccaaaagtattgatgtcttccatatcttgtttcttttttct |
49831470 |
T |
 |
| Q |
212 |
gtaatgctacgttagcaaccagtataatcggattaatttttcttggtaaaaatgggaagttac |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49831469 |
gtaatgctacgttagcaaccagtataatcggattaatttttcttggtaaaaatgggaagttac |
49831407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University