View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15823_high_38 (Length: 270)
Name: NF15823_high_38
Description: NF15823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15823_high_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 253
Target Start/End: Complemental strand, 3327213 - 3326978
Alignment:
| Q |
19 |
cttttgggtattggacacgtcttcacatggcaactagacacaaaacactgagttagggtcatcaagttagtgtacatttagatttggtgataggcatcag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3327213 |
cttttgggtattggacacgtcttcacatggcaactagacacaaaacactgagttagggtcatcaagttagtgtacatttagatttggtgataggcatcag |
3327114 |
T |
|
| Q |
119 |
ctcctttgtgtctttctaattttcaaaatatgtttcacaaagttcaacgatttaattactgataaacaccaatgcaatgaccgtagtaatgtt-aagata |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
3327113 |
ctcctttgcgtctttctaattttcaaaatatgtttcacaaagttcaacgatttaattactgataaacagcaatgcaatgaccgtagtaatgttaaagata |
3327014 |
T |
|
| Q |
218 |
atgcacgtttttgatgagattggatttagatttact |
253 |
Q |
| |
|
|||| | |||| ||||||||||||||||||||||| |
|
|
| T |
3327013 |
atgcgcacttttaatgagattggatttagatttact |
3326978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University