View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15823_high_45 (Length: 237)
Name: NF15823_high_45
Description: NF15823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15823_high_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 2194565 - 2194340
Alignment:
| Q |
1 |
ataaaaatttaagtgtcttaggactttttgttattcttgcatagttgttggcttttcttgaaagttgctatcgtttgttttgattggattgaaatgagtc |
100 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2194565 |
ataaaaatttaagtgttttagcactttttgttattcttgcatagttgttggcttttcttgaaagttgctatcgtttgttttgattggattgaaatgaatc |
2194466 |
T |
|
| Q |
101 |
attgtccttgtagagcttgtattttgtaaatagcaaaatatgtaataaagaatagtttaatatcaatctgtagtatatagccttttgtagaacttgatat |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
2194465 |
attgtccttgtagaacttgtattttgtaaatagcaaaatatgtaataaagaatagtttaatatcaatttgtagtatatagccttttgtagaacttgatct |
2194366 |
T |
|
| Q |
201 |
ttaaaatattatttggaggaattaat |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2194365 |
ttaaaatattatttggaggaattaat |
2194340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University