View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15823_low_13 (Length: 501)
Name: NF15823_low_13
Description: NF15823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15823_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 453; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 453; E-Value: 0
Query Start/End: Original strand, 9 - 493
Target Start/End: Complemental strand, 54809460 - 54808976
Alignment:
| Q |
9 |
tcttggacgtctatgattgatggttttgttaatcatcatctaactgttgaggcaattcagttgtttcagagaatgttggaaggtggagtggatgtcaatg |
108 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54809460 |
tcttggacgtctatgattgctggttttgttaatcatcatctaactgttgaggcaattcagttgtttcagagaatgttggaagttggagtggatgtcaatg |
54809361 |
T |
|
| Q |
109 |
aggctacggtcatttctgttttgagagcttgtgcggattcgggggcgctgagtgtggggaggaaagtgcatgggattgtgaaggagaaggggattgattt |
208 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54809360 |
aggctacggtcatttctgttttgagaggttgtgcggattcgggggcgttgagtgtggggaggaaagtgcatgggattgtgaaggagaaggggattgattt |
54809261 |
T |
|
| Q |
209 |
taaagctaatgtttgtactgcgcttattcatatgtattcgaaatgtgggtgtttagagagtgcaagggaggtgtttgatgatgttttggatagagatgtt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54809260 |
taaagctaatgtttgtactgcgcttattcatatgtattcaaaatgtgggtgtttagagagtgcaagggaggtgtttgatgatgttttggatagagatgtt |
54809161 |
T |
|
| Q |
309 |
tttgtttggactgcgatgatttctggccttgcttgtcacgggatgtgtaaagaagctattgagttgtttcttgaaatggaaacttgtaatgtaaaacccg |
408 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54809160 |
tttgtttggactgcgatgatttatggccttgcttgtcacgggatgtgtaaagaagctattgagttgtttcttgaaatggaaacttgtaatgtaaaacccg |
54809061 |
T |
|
| Q |
409 |
atgagaggacaattacggtggttttatcggcgtataggaatgcaggcttggttcgtgaaggttacatgtttttcgatgatgtcca |
493 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
54809060 |
atgagaggacaattatggtggttttatcggcgtataggaatgcaggcttggttcgtgaaggttacatgtttttcaatgatgtcca |
54808976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University