View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15823_low_39 (Length: 314)
Name: NF15823_low_39
Description: NF15823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15823_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 51 - 193
Target Start/End: Complemental strand, 39687463 - 39687321
Alignment:
| Q |
51 |
ccataagaaggttggcttatgagttgatcttactccaaatctaatccttaaaaaacttgaaattatatgtagcatgtttacttctgcctatcaatgacgg |
150 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39687463 |
ccataagacggttggcttatgagttgatcttactccaaatctaatccttaaaaaacttgaaagtatatgtagcatgtttactactgcctatcaatgacgg |
39687364 |
T |
|
| Q |
151 |
cacatcaagatattcgttagtacttattaccttatacgtgtct |
193 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
39687363 |
cacatcaagatatttgttagtacttagtaccttatacgtgtct |
39687321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 188 - 296
Target Start/End: Complemental strand, 39679697 - 39679589
Alignment:
| Q |
188 |
gtgtctaacacatagattgttagcaaatgaggtttcgaaaattatcttatgtgttacgactacaaaatagttctggtaaattgagggacttttaaacaaa |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39679697 |
gtgtctaacacatagattgttagcaaatgaggtttcgaaaattatcttatgtgttacgactacaaaatagttctggtaaattgagggacttttaaacaaa |
39679598 |
T |
|
| Q |
288 |
catgagggt |
296 |
Q |
| |
|
||||||||| |
|
|
| T |
39679597 |
catgagggt |
39679589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University