View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15823_low_49 (Length: 252)
Name: NF15823_low_49
Description: NF15823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15823_low_49 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 13 - 252
Target Start/End: Original strand, 2573126 - 2573365
Alignment:
| Q |
13 |
acttattagagcatgtcacatttagatatgtatacatatatgtgtgcgcgtgtgttgtgctgcatgttgattagttttataatcaagtattgttatgatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2573126 |
acttattagagcatgtcacatttagatatgtatacatatatgtgtgcgtgtgtgttgtgctgcatgttgattagttttataatcaagtattgttatgatt |
2573225 |
T |
|
| Q |
113 |
gctaggtgggagatggaaacgcggatcataattgttgggagcgtccagaagacatggatacaccaagaacaacttacaagattgattcaaattcccctgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2573226 |
gctaggtgggagatggaaacgcggatcataattgttgggagcgtccagaagacatggatacaccaagaacaacttacaagattgattcaaattcccctgg |
2573325 |
T |
|
| Q |
213 |
aactgaggctgcagctgaggctgctgccgctctctctgct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2573326 |
aactgaggctgcagctgaggctgctgccgctctttctgct |
2573365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 96 - 239
Target Start/End: Original strand, 2563436 - 2563579
Alignment:
| Q |
96 |
caagtattgttatgattgctaggtgggagatggaaacgcggatcataattgttgggagcgtccagaagacatggatacaccaagaacaacttacaagatt |
195 |
Q |
| |
|
|||| |||||| |||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
2563436 |
caagaattgttgtgattgctaggttggagaaggaaacgctgatcataattgttgggagcgtccagaagacatggatactccaagaacactttacaagatt |
2563535 |
T |
|
| Q |
196 |
gattcaaattcccctggaactgaggctgcagctgaggctgctgc |
239 |
Q |
| |
|
||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2563536 |
gatgctaattcccctggaactgaggctgcagctgaggctgctgc |
2563579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University