View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15823_low_50 (Length: 247)
Name: NF15823_low_50
Description: NF15823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15823_low_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 12 - 232
Target Start/End: Original strand, 30833835 - 30834055
Alignment:
| Q |
12 |
atgaacctctcttacctccaaaaacgtctcagtctcatggtatactcctccgcgaaacatttgttcagatgccattgtttttgttttgttatctcacgtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30833835 |
atgaacctctcttacctccaaaaacgtctcagtctcatggtatactcctccgcgaaacatttgttcagatgccattgtttttgttttgttatctcacgtt |
30833934 |
T |
 |
| Q |
112 |
tgaaaacaatcaatgatacactgttctctactattggtgaaaaagaagttgaactgtgagtttaaaagaacaaaatagggacatgtcggtttgaagtctg |
211 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30833935 |
tgaaaacaatcaatcatacactgttctctactattggtgaaaaagaagttgaactgtgagtttaaaagaacaaaataggaacatgtcggtttgaagtctg |
30834034 |
T |
 |
| Q |
212 |
aaatgtgaagaggatgaggtt |
232 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30834035 |
aaatgtgaagaggatgaggtt |
30834055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University