View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15823_low_55 (Length: 228)
Name: NF15823_low_55
Description: NF15823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15823_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 69 - 212
Target Start/End: Original strand, 46633533 - 46633676
Alignment:
| Q |
69 |
atttttagcttcagcaaaataaagtaaattttagcgcataaaattgatttagcaagaaacagatagtttaaaagctttgttaagtttaataattttggaa |
168 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
46633533 |
atttttggcttcagcaaaataaactaaattttagcgcataaaattgatttagcaagaaacagatagtttaaaggctttgttgagtttaataattttggaa |
46633632 |
T |
 |
| Q |
169 |
gtcatctcaccatttatttgctttgcaaaagctttaaacctttg |
212 |
Q |
| |
|
||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46633633 |
gtcctatcaccatttatttgctttgcaaaagctttaaacctttg |
46633676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 46633436 - 46633483
Alignment:
| Q |
19 |
aaattacagtgcaaaatttagtatttgtttgatttcacgttgcaaact |
66 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
46633436 |
aaattacagtgcaaaatttagtacttatttgatttcacgttgcaaact |
46633483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University