View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15823_low_57 (Length: 212)

Name: NF15823_low_57
Description: NF15823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15823_low_57
NF15823_low_57
[»] chr7 (1 HSPs)
chr7 (16-195)||(3643329-3643508)
[»] chr3 (2 HSPs)
chr3 (15-194)||(16351341-16351520)
chr3 (15-192)||(11991603-11991780)
[»] scaffold0019 (2 HSPs)
scaffold0019 (15-192)||(125654-125831)
scaffold0019 (31-139)||(123853-123960)
[»] scaffold0014 (4 HSPs)
scaffold0014 (15-190)||(140551-140726)
scaffold0014 (19-149)||(104312-104442)
scaffold0014 (19-149)||(137669-137799)
scaffold0014 (49-160)||(121043-121154)
[»] scaffold0051 (1 HSPs)
scaffold0051 (15-140)||(47486-47611)
[»] chr1 (1 HSPs)
chr1 (15-136)||(41316551-41316672)
[»] scaffold0654 (1 HSPs)
scaffold0654 (59-151)||(792-884)
[»] chr6 (6 HSPs)
chr6 (49-151)||(15714564-15714666)
chr6 (97-163)||(29898446-29898512)
chr6 (97-151)||(24263324-24263378)
chr6 (97-151)||(29867022-29867076)
chr6 (106-151)||(29365993-29366038)
chr6 (30-138)||(29894859-29894967)
[»] scaffold0308 (1 HSPs)
scaffold0308 (91-192)||(9362-9463)
[»] scaffold0086 (1 HSPs)
scaffold0086 (111-160)||(30881-30930)
[»] chr5 (1 HSPs)
chr5 (15-140)||(33497892-33498017)
[»] scaffold0652 (1 HSPs)
scaffold0652 (49-151)||(867-969)
[»] scaffold0177 (1 HSPs)
scaffold0177 (62-151)||(27691-27780)


Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 16 - 195
Target Start/End: Original strand, 3643329 - 3643508
Alignment:
16 atgaagcagaggtcttgttgtccaaaatgaagaacaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatga 115  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||    
3643329 atgaagcagaggtcttgttgtccaaaatggagaacaatggtatcattcctgatgctgtaacgtatgaaactatcatccgggctctctttcgtaaagatga 3643428  T
116 gaacgaaaaggcggagaaacttctttgtgaaatgatcattagaggcctcctataatgcaaacactaggtaagatgatctt 195  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
3643429 gaacgaaaaggcggagaaacttcttcgtgaaatgatcattagaggcctcctattatgcaaacactaggtaagatgatctt 3643508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 15 - 194
Target Start/End: Original strand, 16351341 - 16351520
Alignment:
15 gatgaagcagaggtcttgttgtccaaaatgaagaacaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatg 114  Q
    ||||||||||||||||||||||| |||||| || ||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |    
16351341 gatgaagcagaggtcttgttgtcaaaaatggaggacaatggtatcattcctgatgctgtaacttatgaaactatcatccaggctctctttcataaagacg 16351440  T
115 agaacgaaaaggcggagaaacttctttgtgaaatgatcattagaggcctcctataatgcaaacactaggtaagatgatct 194  Q
    |||||||||||||  ||||||||||| |||||||| |||||| ||| ||||||||||| |||||||||||||||||||||    
16351441 agaacgaaaaggcacagaaacttcttcgtgaaatggtcattaaaggtctcctataatggaaacactaggtaagatgatct 16351520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 15 - 192
Target Start/End: Original strand, 11991603 - 11991780
Alignment:
15 gatgaagcagaggtcttgttgtccaaaatgaagaacaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatg 114  Q
    ||||||||||||| ||||||||| |||||| |  ||||||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||||||||    
11991603 gatgaagcagaggccttgttgtcaaaaatggatgacaatggtatcattcctgatgctgtaacttatgaaactctcatccaggctctctttcataaagatg 11991702  T
115 agaacgaaaaggcggagaaacttctttgtgaaatgatcattagaggcctcctataatgcaaacactaggtaagatgat 192  Q
    |||| ||||||||||||||||||||  ||||||||||   |||||| ||||||| ||| |||||||||||||||||||    
11991703 agaatgaaaaggcggagaaacttctgcgtgaaatgattgctagaggtctcctatgatggaaacactaggtaagatgat 11991780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: scaffold0019
Description:

Target: scaffold0019; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 15 - 192
Target Start/End: Complemental strand, 125831 - 125654
Alignment:
15 gatgaagcagaggtcttgttgtccaaaatgaagaacaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatg 114  Q
    |||||||| ||||||||| |||| |||||| |  ||||||| || |||||||||| |||||| |||||||||||||||| |||| |||||||||||||||    
125831 gatgaagcggaggtcttgctgtcaaaaatggaagacaatggcataattcctgatgctgtaacttatgaaactatcatccgggctttctttcataaagatg 125732  T
115 agaacgaaaaggcggagaaacttctttgtgaaatgatcattagaggcctcctataatgcaaacactaggtaagatgat 192  Q
    |||| ||||||||||||||||||||| ||||||||||   |||||| || ||  |||| |||||||||||||||||||    
125731 agaatgaaaaggcggagaaacttcttcgtgaaatgattgctagaggtctacttaaatggaaacactaggtaagatgat 125654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0019; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 139
Target Start/End: Complemental strand, 123960 - 123853
Alignment:
31 tgttgtccaaaatgaagaacaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatgagaacgaaaaggcgga 130  Q
    ||||||| |||||| |  ||||||||  ||||||| |||| ||||| || ||||| || ||||| ||||| ||| | || |||||||||||||| || ||    
123960 tgttgtcaaaaatggaagacaatggttgcattcctaatgtagtaacttaagaaacaattatccacgctctttttaaaaatgatgagaacgaaaa-gcaga 123862  T
131 gaaacttct 139  Q
    |||||||||    
123861 gaaacttct 123853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 84; Significance: 4e-40; HSPs: 4)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 15 - 190
Target Start/End: Original strand, 140551 - 140726
Alignment:
15 gatgaagcagaggtcttgttgtccaaaatgaagaacaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatg 114  Q
    ||||||| ||| | |||| |||| |||||| |  ||||||||||||||||||||| |||||| |||| ||||||||||| ||||||||||||||||||||    
140551 gatgaagtagatgccttgatgtctaaaatggatgacaatggtatcattcctgatgctgtaacttatgtaactatcatccgggctctctttcataaagatg 140650  T
115 agaacgaaaaggcggagaaacttctttgtgaaatgatcattagaggcctcctataatgcaaacactaggtaagatg 190  Q
    |||| ||| ||||||||||||||||| ||||||||||   |||||| || |||||||| | ||||||||| |||||    
140651 agaatgaacaggcggagaaacttcttcgtgaaatgattgctagaggtctactataatggagacactaggtgagatg 140726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 19 - 149
Target Start/End: Complemental strand, 104442 - 104312
Alignment:
19 aagcagaggtcttgttgtccaaaatgaagaacaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatgagaa 118  Q
    ||||||||| ||||||||| |||||||||   |||| | |||||||||||| |||||| ||||||||||| |||||  |||||||| |||||||||||||    
104442 aagcagaggccttgttgtcaaaaatgaagggtaatgatgtcattcctgatgctgtaacttatgaaactattatccactctctcttttataaagatgagaa 104343  T
119 cgaaaaggcggagaaacttctttgtgaaatg 149  Q
     ||||| ||||||||||||||| ||||||||    
104342 tgaaaaagcggagaaacttcttcgtgaaatg 104312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 149
Target Start/End: Original strand, 137669 - 137799
Alignment:
19 aagcagaggtcttgttgtccaaaatgaagaacaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatgagaa 118  Q
    ||||||||| ||||||||| |||||| || | |||| ||||| |||| |||||||||| ||||||||||| ||||   |||||||| |||||||| | ||    
137669 aagcagaggccttgttgtcaaaaatggaggataatgatatcaatcctaatgttgtaacttatgaaactattatccgctctctcttttataaagattacaa 137768  T
119 cgaaaaggcggagaaacttctttgtgaaatg 149  Q
     ||||||||||||||||||||| ||||||||    
137769 tgaaaaggcggagaaacttcttcgtgaaatg 137799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 49 - 160
Target Start/End: Complemental strand, 121154 - 121043
Alignment:
49 acaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatgagaacgaaaaggcggagaaacttctttgtgaaat 148  Q
    ||||||||  || ||||||||||||||| ||||||||||| ||  | ||||| ||| | || |||||||| || ||||| |||||||||||  |||||||    
121154 acaatggttgcactcctgatgttgtaacttatgaaactattatttacgctctttttaaaaatgatgagaatgataaggcagagaaacttctacgtgaaat 121055  T
149 gatcattagagg 160  Q
    ||| | ||||||    
121054 gattactagagg 121043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: scaffold0051
Description:

Target: scaffold0051; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 15 - 140
Target Start/End: Complemental strand, 47611 - 47486
Alignment:
15 gatgaagcagaggtcttgttgtccaaaatgaagaacaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatg 114  Q
    |||||||  |||| ||||||||| |||||| || ||||||||||  ||||| ||| |||||| ||||||||||| |||| ||||||||||||||||||      
47611 gatgaagtggaggccttgttgtcaaaaatggaggacaatggtatacttcctaatgctgtaacttatgaaactattatccgggctctctttcataaagact 47512  T
115 agaacgaaaaggcggagaaacttctt 140  Q
     ||| |||||||| ||||||||||||    
47511 tgaatgaaaaggcagagaaacttctt 47486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 15 - 136
Target Start/End: Original strand, 41316551 - 41316672
Alignment:
15 gatgaagcagaggtcttgttgtccaaaatgaagaacaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatg 114  Q
    |||||||||||||  |||||||| |||||| |  || ||||||||||||||||||  ||||| ||||||||||  || |  || |||||||||||||| |    
41316551 gatgaagcagaggcgttgttgtcaaaaatggatgactatggtatcattcctgatgccgtaacttatgaaactaatattcgcgcactctttcataaagacg 41316650  T
115 agaacgaaaaggcggagaaact 136  Q
    |||| |||||||| ||||||||    
41316651 agaatgaaaaggcagagaaact 41316672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0654 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0654
Description:

Target: scaffold0654; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 59 - 151
Target Start/End: Complemental strand, 884 - 792
Alignment:
59 cattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatgagaacgaaaaggcggagaaacttctttgtgaaatgat 151  Q
    |||||||||||||||||||||||||||||| || |  ||||| ||| | || |||||||| || | ||| |||||||||||  ||||||||||    
884 cattcctgatgttgtaacgtatgaaactattattcgcgctctttttaaaaatgatgagaatgatagggcagagaaacttctacgtgaaatgat 792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.00000000007; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 49 - 151
Target Start/End: Complemental strand, 15714666 - 15714564
Alignment:
49 acaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatgagaacgaaaaggcggagaaacttctttgtgaaat 148  Q
    ||||||||  |||||| |||| |||||| |||||||| || ||||  ||||||||| | || |||||||| || ||||| |||||||||||  |||||||    
15714666 acaatggttgcattccagatgctgtaacttatgaaacaattatccgtgctctctttaaaaatgatgagaatgataaggcagagaaacttctgcgtgaaat 15714567  T
149 gat 151  Q
    |||    
15714566 gat 15714564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 97 - 163
Target Start/End: Original strand, 29898446 - 29898512
Alignment:
97 ctctctttcataaagatgagaacgaaaaggcggagaaacttctttgtgaaatgatcattagaggcct 163  Q
    |||| ||| |||||||||| || || |||||||||||||||||| |||||||||| || ||||||||    
29898446 ctctgtttgataaagatgaaaatgataaggcggagaaacttcttcgtgaaatgattatgagaggcct 29898512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 151
Target Start/End: Complemental strand, 24263378 - 24263324
Alignment:
97 ctctctttcataaagatgagaacgaaaaggcggagaaacttctttgtgaaatgat 151  Q
    |||| ||| |||||||||| || || |||||||||||||||||| ||||||||||    
24263378 ctctgtttgataaagatgaaaatgataaggcggagaaacttcttcgtgaaatgat 24263324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 151
Target Start/End: Original strand, 29867022 - 29867076
Alignment:
97 ctctctttcataaagatgagaacgaaaaggcggagaaacttctttgtgaaatgat 151  Q
    |||| ||| |||||||||| || || |||||||||||||||||| ||||||||||    
29867022 ctctgtttgataaagatgaaaatgataaggcggagaaacttcttcgtgaaatgat 29867076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 106 - 151
Target Start/End: Complemental strand, 29366038 - 29365993
Alignment:
106 ataaagatgagaacgaaaaggcggagaaacttctttgtgaaatgat 151  Q
    |||||||||| || || |||||||||||||||||| ||||||||||    
29366038 ataaagatgaaaatgataaggcggagaaacttcttcgtgaaatgat 29365993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 138
Target Start/End: Original strand, 29894859 - 29894967
Alignment:
30 ttgttgtccaaaatgaagaacaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatgagaacgaaaaggcgg 129  Q
    |||||||| ||||||||  ||||| ||  |||||| |||| |||||| |||||||  |||||||   | || ||| |||||||||| || || |||||||    
29894859 ttgttgtcaaaaatgaaagacaatagttgcattccagatgctgtaacttatgaaataatcatccgttccctgtttgataaagatgaaaatgataaggcgg 29894958  T
130 agaaacttc 138  Q
    |||||||||    
29894959 agaaacttc 29894967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0308 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0308
Description:

Target: scaffold0308; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 91 - 192
Target Start/End: Original strand, 9362 - 9463
Alignment:
91 tccaggctctctttcataaagatgagaacgaaaaggcggagaaacttctttgtgaaatgatcattagaggcctcctataatgcaaacactaggtaagatg 190  Q
    |||| ||||||||| | || ||||||||||||||||| |||||||||||  ||||||||||   |||||| || |||||| | ||  ||||| |||||||    
9362 tccacgctctctttaaaaatgatgagaacgaaaaggcagagaaacttctacgtgaaatgattgctagaggtctactataaggaaagtactagttaagatg 9461  T
191 at 192  Q
    ||    
9462 at 9463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0086 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0086
Description:

Target: scaffold0086; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 30930 - 30881
Alignment:
111 gatgagaacgaaaaggcggagaaacttctttgtgaaatgatcattagagg 160  Q
    |||||||| ||||||||||||||||||||| ||||||||||  |||||||    
30930 gatgagaatgaaaaggcggagaaacttcttcgtgaaatgattgttagagg 30881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 140
Target Start/End: Complemental strand, 33498017 - 33497892
Alignment:
15 gatgaagcagaggtcttgttgtccaaaatgaagaacaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatg 114  Q
    ||||||| |||||  | |||||| |||||  || |||||| |||||||||| |   |||||| ||||||| | | |||| | ||||||||||||||||||    
33498017 gatgaagtagaggattagttgtcaaaaatagaggacaatgctatcattccttagagtgtaacttatgaaattgttatccggtctctctttcataaagatg 33497918  T
115 agaacgaaaaggcggagaaacttctt 140  Q
    |||| || ||| | ||||||||||||    
33497917 agaatgagaagacagagaaacttctt 33497892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0652 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0652
Description:

Target: scaffold0652; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 49 - 151
Target Start/End: Complemental strand, 969 - 867
Alignment:
49 acaatggtatcattcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatgagaacgaaaaggcggagaaacttctttgtgaaat 148  Q
    ||||||||  ||||||  ||| |||||| |||| ||| || ||||| ||||||||| | || |||||||| || ||||| |||||||||||  |||||||    
969 acaatggttgcattccaaatgctgtaacttatgcaacaattatccatgctctctttaaaaatgatgagaatgataaggcagagaaacttctacgtgaaat 870  T
149 gat 151  Q
    |||    
869 gat 867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0177 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0177
Description:

Target: scaffold0177; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 62 - 151
Target Start/End: Original strand, 27691 - 27780
Alignment:
62 tcctgatgttgtaacgtatgaaactatcatccaggctctctttcataaagatgagaacgaaaaggcggagaaacttctttgtgaaatgat 151  Q
    ||||||||||||||| ||||||||||| || |  ||||| ||| | || ||||||||| | || || |||||||||||  ||||||||||    
27691 tcctgatgttgtaacttatgaaactattattcgcgctctttttaaaaatgatgagaaccataaagcagagaaacttctacgtgaaatgat 27780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University