View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15823_low_59 (Length: 205)
Name: NF15823_low_59
Description: NF15823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15823_low_59 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 182
Target Start/End: Complemental strand, 42623452 - 42623289
Alignment:
| Q |
19 |
ctacaaaccctaattttgatctgtgtaacggttaacatggcttcttctggacacttcaagttgttgaagaggaaattcgatggcaccgtcgttcaaatcg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42623452 |
ctacaaaccctaattttgatctgtgtaacggttaacatggcttcttctggacacttcaagttgttgaagaggaaactcgatggcaccgtcgttcaaatcg |
42623353 |
T |
 |
| Q |
119 |
gtgacgatttctccgatttctctctttcttctccggctactaaaattcgccgcctcgtacgtac |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42623352 |
gtgacgatttctccgatttctctctttcttctccggctactaaaattcgccgcctcgtacgtac |
42623289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University