View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15824_low_4 (Length: 371)
Name: NF15824_low_4
Description: NF15824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15824_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 9e-86; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 4 - 212
Target Start/End: Complemental strand, 35243984 - 35243780
Alignment:
| Q |
4 |
cacagatgggattatgttgtctcatatcacacgattggcttatggagcaaatatcgnnnnnnnctgagtaatacagcaactatagttagaggaatagttg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35243984 |
cacagatgggattatgttgtctcatatcacacgattggcttatggagcaaatatcgtttttt-ctgagtaatacagcaactatagttataggaatagttg |
35243886 |
T |
|
| Q |
104 |
gtttgtgcagaattaaactttaaaccatgactctttcatagtatatagcatattaatttcattaatttatcatgtgagactgaaacctagagctacgaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35243885 |
gtttgtgcagaattaaactttaaaccatgactctttca---tatatagcatattaatttcattaatttatcatgtgagactgaaacctagagctactaat |
35243789 |
T |
|
| Q |
204 |
gatcaatac |
212 |
Q |
| |
|
||||||||| |
|
|
| T |
35243788 |
gatcaatac |
35243780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 226 - 358
Target Start/End: Complemental strand, 35243724 - 35243592
Alignment:
| Q |
226 |
cccatttgttttacaagtttcttctaaaatacttaccttaacttctactatgaatcctccacaatagattcaatgaatctccgaagcaccttccttatca |
325 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35243724 |
cccatttcttttacaagttttttctaaaatacttaccttaacttctactatgaatcctccacaatagattcaatgaatctccgaagcaccttccttatca |
35243625 |
T |
|
| Q |
326 |
gaaattctctacaaagtacaaagcatacacaaa |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35243624 |
gaaattctctacaaagtacaaagcatacacaaa |
35243592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 303 - 341
Target Start/End: Complemental strand, 35232211 - 35232173
Alignment:
| Q |
303 |
tctccgaagcaccttccttatcagaaattctctacaaag |
341 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
35232211 |
tctccaaagcaccttccttatcacaaattctctacaaag |
35232173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University