View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15825_high_19 (Length: 251)
Name: NF15825_high_19
Description: NF15825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15825_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 13976277 - 13976490
Alignment:
| Q |
19 |
acacataacataatgactatattcgaggatataggaatgaaattcttacataatatgaaaagnnnnnnnnnnnngtttgtctttttctcttcaattggat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
13976277 |
acacataacataatgactatattcgaggatataggaatgaaattcttacataatatgaaaagcttttttttt--gtttgtctttttc-cttcaattggat |
13976373 |
T |
 |
| Q |
119 |
taggtttatgtctcctcaatttatttttcataaatgaatttctatcagat-nnnnnnnnnttacttatatcgttttgtgctatcataacaaatatatatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13976374 |
taggtttatgtctcctcaatttatttttcataaatgaatttctatcagataaaaaaaatattacttatatcgttttgtgctatcataacaaatatatatc |
13976473 |
T |
 |
| Q |
218 |
tcagatgcatttgccta |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13976474 |
tcagatgcatttgccta |
13976490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 66
Target Start/End: Original strand, 250316 - 250349
Alignment:
| Q |
33 |
gactatattcgaggatataggaatgaaattctta |
66 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
250316 |
gactatattcgagcatataggaatgaaattctta |
250349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University