View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15825_low_17 (Length: 277)
Name: NF15825_low_17
Description: NF15825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15825_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 41923890 - 41923622
Alignment:
| Q |
1 |
atgagaaagaggaaaagagaaagcagcgacggtgctggtcgcaggagttgcacaagcgattcttgaaggcgcttcagcagcttggtggtgcagattgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41923890 |
atgagaaagaggaaaagagaaaacagcgacggtgctggtcgcaggagttgcacaagcgattcctgaaggcgcttcagcagcttggtggtgcagattgtga |
41923791 |
T |
|
| Q |
101 |
gtatcttaatatatacatc-aagttctgattgttatgtgttcatgttgttaatgtaattaactgcaaat-tgaatagatgcttaatgtgnnnnnnngctt |
198 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||| |||||| || |||||| ||| |||| |||| |
|
|
| T |
41923790 |
gtatcttaatatatacatcaaagttctgattattatgtattcatgttgttaatgtaattaaccgcaaataggattagatgtttattgtgtttttttgctt |
41923691 |
T |
|
| Q |
199 |
ctgttctataggtgccacaccaaagcaaatcagagaggtaatgaatgttgatggcctcacaaatgatga |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41923690 |
ctgttctataggtgccacaccaaagcaaatcagagaggtaatgaatgttgatggcctcacaaatgatga |
41923622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University